| Title | Aspergillus nidulans의 tRNA 유전자의 구조와 발현에 관한 연구 (VI); Aspergillus nidulans의 tRNA 유전자의 분자구조 | ||
| Author | 이병재 · 강현삼 | ||
| Address | 서울대학교 자연대학 미생물학과 | ||
| Bibliography | Korean Journal of Microbiology, 24(3),204-210, 1986 | ||
| DOI | |||
| Key Words | Aspergillus nidulans, tRNA ^Arg gene, DNA sequences | ||
| Abstract | One clone(pANt32) carring tRNA^Arg gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT-TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions. | ||
| Download PDF | Kor_240302_204-210p.pdf | ||